Skip Navigation

Reagents and Scientific Resources

(Reagents are available for distribution with suitable Materials Transfer Agreements, Bioreagents Sharing Agreements, and other collaborative arrangements. All Materials Transfer Agreements are subject to approval by the University of Minnesota and subject to the laws and restrictions of the State of Minnesota)

Cell Lines:

1. Canine Melanoma

  1. TLM-1 (Ritt et al, Vet Pathol 1998 Mar;35(2):94-101)
  2. CMGD-2 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
  3. CMGD-3 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
  4. CMGD-4 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
  5. CMGD-5 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
  6. Lines from other investigators
    1. CML-2 (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
    2. CML-13 (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
    3. JENNY (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
    4. SHADOW (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
    5. SCOOTER (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
    6. BEAR (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)

2. Canine Hemangiosarcoma and other Soft Tissue Sarcomas

  1. Dal-4 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  2. DD-1 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  3. CHAD-G4 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  4. CHAD-G6 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  5. CHAD-B7 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  6. CHAD-G8 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  7. CHAD-P9 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
  8. Mocha-HSA (Lamerato et al, Exp Hematol. 2006 July;34(7):870-878)
  9. Frog-HSA (Lamerato et al, Exp Hematol. 2006 July;34(7):870-878)
  10. Joey-HSA (unpublished)
  11. Journey-HSA (unpublished)
  12. Connor-HSA (unpublished)
  13. Veronica-HSA (unpublished)
  14. Tucker-HSA (unpublished)
  15. Spry-STS (unpublished)
  16. Max-ST (unpublished)
  17. Lines from other investigators
    1. SB-HSA (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)

3. Canine Osteosarcoma

  1. OSCA-1 to OSCA-75 (see Thomas et al Genome Res 2005 Dec;15(12):1831-1837; Modiano et al Gene Ther Mol Biol. 2006 Jan;10(1):31-40)

4. Feline Tumors

  1. K12 feline mammary carcinoma (Modiano et al, J Cell Biochem. 1991 Feb;45(2):196-206)

5. Human Lymphoma/Leukemia

  1. Jurkat (J32, E-6) (Frazer-Abel et al, JPET. 2004 Nov;311(2):758-69)
  2. K562 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
  3. HL-60 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
  4. U937 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
  5. Kit-225 (Modiano et al, J Immunol. 2000 Dec 15;165(12):6693-702)

6. Other human tumors

  1. A431 (Modiano et al, J Cell Biochem. 1991 Feb;45(2):196-206)
  2. Hep-G2

7. Murine

  1. CTLL-2 (Modiano et al, J Biol Chem. 1991 Jun 5;266(16):10552-61)
  2. EL-4

8. Other

  1. MLA-144 Gibbon-ape leukemia (Modiano et al, J Biol Chem. 1991 Jun 5;266(16):10552-61)

Constructs

  1. CDK4 reporters (human) (Baksh et al, Mol Cell. 2002 Nov;10(5):1071-81)
  2. GFP-NFATc2 (human) (Frazer-Abel et al, JPET. 2004 Nov;311(2):758-69)
  3. GFP-PTEN (canine) (Dickerson et al, Vet Pathol. 2005 in press)
  4. PTEN siRNA (canine) (unpublished – RESTRICTED ACCESS)
  5. RSV-p21 (human) (Ritt et al, Cancer Lett. 2000 Sep 29;158(1):73-84)
  6. RSV-p21 AS (human) (unpublished – RESTRICTED ACCESS)
  7. RSV-p16 (human) (Modiano et al, J Immunol. 2000 Dec 15;165(12):6693-702)
  8. ß4-nAChR siRNA (human) (unpublished – RESTRICTED ACCESS)
  9. alpha7-nAChR siRNA (human) (unpublished – (unpublished – RESTRICTED ACCESS)

Sequence Information

Homo sapiens cyclin-dependent kinase 4 (CDK4) gene, partial sequence
gi|14289133|gb|AY034380.1|[14289133] PubMed

Canis familiaris death factor CD95 mRNA, partial cds
gi|22759129|gb|AF536812.1|[22759129] PubMed

Canis familiaris cyclin-dependent kinase inhibitor (WAF1) mRNA, partial cds
gi|3342503|gb|AF076469.1|AF076469[3342503] PubMed

Canis familiaris cyclin-dependent kinase 4/6 inhibitor-a gene, partial cds
gi|9858564|gb|AF234176.1|AF234176[9858564] PubMed

Methods

NFATc2 Activation ELISA
see: Frazer-Abel et al. J Pharmacol Exp Ther. 2004 311:758

A multi-well assay was adapted to examine the capacity of NFAT to bind the core element of the CDK4 promoter. Two-hundred base pair oligonucleotides from the CDK4 5’-flanking region (+45 to -155) containing wild type or mutant NFATc2 binding sites at position +11 (exon 1) were generated by PCR amplification from the B/FB fragment or the M1 mutant fragment, respectively, as templates (Baksh et al., 2002). The forward primer (5’-CGCCGCTCGAGAATGTCAAGCG-3’) was biotinylated at the 5’ end; the reverse primer (GCCCAAGCTTATGTGACCAGCTGCC) was not labeled. Biotinylated oligonucleotides were bound to streptavidin-coated 96 well plates (Roche) for 1 hr at 37ºC in PBS. After washing, 20 µl containing purified HA-tagged NFATc2 (Baksh et al., 2002) or 10 µl of nuclear extracts were mixed with 30 µl binding buffer (4 mM HEPES pH 7.4, 100 mM KCl, 8% glycerol, 5 mM DTT, 0.2% BSA, and 0.016% poly d (I-C)) and incubated for 1 hr at 25ºC. Anti-NFAT antibody (Santa Cruz) was added at a 1:1,000 dilution in PBS with 1% non-fat dried milk for one hr at 25ºC followed by a secondary antibody conjugated to HRP. The color reaction was visualized using a Substrate Reagent Pack (R&D Systems). Absorbance was measured at 450 nm with correction at 540 nm. Absorbance of sham treated wells containing oligonucleotide, but not protein or nuclear extract, was considered background.