|
|
Reagents and Scientific Resources
(Reagents are available for distribution with suitable Materials Transfer
Agreements, Bioreagents Sharing Agreements, and other collaborative
arrangements. All Materials Transfer Agreements are subject to approval
by the University of Minnesota and subject to the laws and restrictions
of the State of Minnesota)
Cell Lines:
1. Canine Melanoma
- TLM-1 (Ritt et al, Vet Pathol 1998 Mar;35(2):94-101)
- CMGD-2 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
- CMGD-3 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
- CMGD-4 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
- CMGD-5 (Bianco et al, Cancer Gene Ther. 2003 Sep;10(9):726-36)
- Lines from other investigators
- CML-2 (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
- CML-13 (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
- JENNY (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
- SHADOW (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
- SCOOTER (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
- BEAR (Koenig et al, Vet Pathol. 2001 Jul;38(4):427-35)
2. Canine Hemangiosarcoma and other Soft Tissue Sarcomas
- Dal-4 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- DD-1 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- CHAD-G4 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- CHAD-G6 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- CHAD-B7 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- CHAD-G8 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- CHAD-P9 (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
- Mocha-HSA (Lamerato et al, Exp Hematol. 2006 July;34(7):870-878)
- Frog-HSA (Lamerato et al, Exp Hematol. 2006 July;34(7):870-878)
- Joey-HSA (Tamburini et al, PLoS ONE 2009 May; 4(5):e5549)
- Journey-HSA (Tamburini et al, PLoS ONE 2009 May; 4(5):e5549)
- Connor-HSA (unpublished)
- Veronica-HSA (Tamburini et al, PLoS ONE 2009 May; 4(5):e5549)
- Tucker-HSA (Tamburini et al, PLoS ONE 2009 May; 4(5):e5549)
- Emma-HSA (Tamburini et al, PLoS ONE 2009 May; 4(5):e5549)
- Grace-HSA (unpublished)
- Spry-STS (unpublished)
- Max-ST (unpublished)
- Lines from other investigators
- SB-HSA (Fosmire et al, Lab Invest. 2004 May;84(5):562-72)
3. Canine Osteosarcoma
- OSCA-1 to OSCA-78 (see Thomas et al Genome Res 2005 Dec;15(12):1831-1837; Modiano et al Gene Ther Mol Biol. 2006 Jan;10(1):31-40)
4. Feline Tumors
- K12 feline mammary carcinoma (Modiano et al, J Cell Biochem. 1991
Feb;45(2):196-206)
5. Human Lymphoma/Leukemia
- Jurkat (J32, E-6) (Frazer-Abel et al, JPET. 2004 Nov;311(2):758-69)
- K562 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
- HL-60 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
- U937 (Khare et al, Eur J Pharmacol. 2003 Mar 28;465(1-2):23-30)
- Kit-225 (Modiano et al, J Immunol. 2000 Dec 15;165(12):6693-702)
6. Other human tumors
- A431 (Modiano et al, J Cell Biochem. 1991 Feb;45(2):196-206)
- Hep-G2
7. Murine
- CTLL-2 (Modiano et al, J Biol Chem. 1991 Jun 5;266(16):10552-61)
- EL-4
8. Other
- MLA-144 Gibbon-ape leukemia (Modiano et al, J Biol Chem. 1991 Jun
5;266(16):10552-61)
Constructs
- CDK4 reporters (human) (Baksh et al, Mol Cell. 2002 Nov;10(5):1071-81)
- GFP-NFATc2 (human) (Frazer-Abel et al, JPET. 2004 Nov;311(2):758-69)
- GFP-PTEN (canine) (Dickerson et al, Vet Pathol. 2005 in press)
- PTEN siRNA (canine) (unpublished – RESTRICTED ACCESS)
- RSV-p21 (human) (Ritt et al, Cancer Lett. 2000 Sep 29;158(1):73-84)
- RSV-p21 AS (human) (unpublished – RESTRICTED ACCESS)
- RSV-p16 (human) (Modiano et al, J Immunol. 2000 Dec 15;165(12):6693-702)
- Beta4-nAChR siRNA (human) (unpublished – RESTRICTED ACCESS)
- alpha7-nAChR siRNA (human) (unpublished – RESTRICTED
ACCESS)
- alpha3-nAChR siRNA (human) (unpublished – RESTRICTED ACCESS)
- alpha4-nAChR siRNA (human) (unpublished – RESTRICTED ACCESS)
- Beta2-nAChR siRNA (human) (unpublished – RESTRICTED ACCESS)
Sequence Information
Homo sapiens cyclin-dependent kinase 4 (CDK4) gene, partial sequence
gi|14289133|gb|AY034380.1|[14289133] PubMed
Canis familiaris death factor CD95 mRNA, partial cds
gi|22759129|gb|AF536812.1|[22759129] PubMed
Canis familiaris cyclin-dependent kinase inhibitor (WAF1) mRNA, partial
cds
gi|3342503|gb|AF076469.1|AF076469[3342503] PubMed
Canis familiaris cyclin-dependent kinase 4/6 inhibitor-a gene, partial
cds
gi|9858564|gb|AF234176.1|AF234176[9858564] PubMed
Methods
NFATc2 Activation ELISA
see: Frazer-Abel
et al. J Pharmacol Exp Ther. 2004 311:758
A multi-well assay was adapted to examine the capacity of NFAT to
bind the core element of the CDK4 promoter. Two-hundred base pair oligonucleotides
from the CDK4 5’-flanking region (+45 to -155) containing wild
type or mutant NFATc2 binding sites at position +11 (exon 1) were generated
by PCR amplification from the B/FB fragment or the M1 mutant fragment,
respectively, as templates (Baksh
et al., 2002). The forward primer
(5’-CGCCGCTCGAGAATGTCAAGCG-3’) was biotinylated at the
5’ end; the reverse primer (GCCCAAGCTTATGTGACCAGCTGCC) was not
labeled. Biotinylated oligonucleotides were bound to streptavidin-coated
96 well plates (Roche) for 1 hr at 37ºC in PBS. After washing,
20 µl containing purified HA-tagged NFATc2 (Baksh
et al., 2002)
or 10 µl of nuclear extracts were mixed with 30 µl binding
buffer (4 mM HEPES pH 7.4, 100 mM KCl, 8% glycerol, 5 mM DTT, 0.2%
BSA, and 0.016% poly d (I-C)) and incubated for 1 hr at 25ºC.
Anti-NFAT antibody (Santa Cruz) was added at a 1:1,000 dilution in
PBS with 1% non-fat dried milk for one hr at 25ºC followed by
a secondary antibody conjugated to HRP. The color reaction was visualized
using a Substrate Reagent Pack (R&D Systems). Absorbance was measured
at 450 nm with correction at 540 nm. Absorbance of sham treated wells
containing oligonucleotide, but not protein or nuclear extract, was
considered background.
|